Data Search

Find folding metrics (explained here) within the human reference genome (GRCh38/hg38) based on their genomic coordinates, or find specific regions which have interesting folding properties (by filtering based on their folding metric values).

You can browse the data visually using JBrowse - user guide here.

If you would like to find data for specific genes use the Gene Search tool.

Users are limited to downloading about 2.5 million nucleotides worth of a data at a time. If you would like the entire data set it can be found here.

Download your results by clicking the "CSV" download button at the bottom of the page.

Select data from a specific chromosome.
Data export restricted to 2.5M nucleotides at a time.
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 18,915,481
Ending coordinate (hg38): 18,915,600
Minimum free energy (kcal/mol): -26.3
z-score: -1.16
p-value of z-score: 0.12
Ensemble Diversity: 9.65
Frequency of MFE in ensemble: 0.12
Sequence & Folding Structure:
GCUCACUUUUCUUCUCCACCAUGUUUCAACCUAGUGUGUGGCCCUCACCAGAAACUGCCAGAUGUGAUGCUAUGCUCUUUAACUUACCAGCCCGAAGAACUGUGAGCUAAAUAAAGUGUC
((((((..((((((.......((.........((.(((((((..(((((((...)))......)))).))))))).)).........))....))))))..)))))).............
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 18,915,521
Ending coordinate (hg38): 18,915,640
Minimum free energy (kcal/mol): -13.5
z-score: 1.299
p-value of z-score: 0.83
Ensemble Diversity: 33.8
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
UCGUUUCCUCUCUUGCCAUGUGAUUUCUCUGCACCCGCCUGCUCACUUUUCUUCUCCACCAUGUUUCAACCUAGUGUGUGGCCCUCACCAGAAACUGCCAGAUGUGAUGCUAUGCUCUUU
...................((((.......(((......)))))))..........................((.(((((((..(((((((...)))......)))).))))))).))..
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 18,915,561
Ending coordinate (hg38): 18,915,680
Minimum free energy (kcal/mol): -20
z-score: -0.36
p-value of z-score: 0.32
Ensemble Diversity: 25.57
Frequency of MFE in ensemble: 0.03
Sequence & Folding Structure:
ACAGGUUGUUAUAAAAAUGAGUUUGGCUUCCCAGGCUCUCUCGUUUCCUCUCUUGCCAUGUGAUUUCUCUGCACCCGCCUGCUCACUUUUCUUCUCCACCAUGUUUCAACCUAGUGUGUG
((((((((..(((.....((((((((....)))))))).....................((((.......(((......)))))))...............)))..)))))).)).....
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 18,915,601
Ending coordinate (hg38): 18,915,720
Minimum free energy (kcal/mol): -27
z-score: -0.44
p-value of z-score: 0.29
Ensemble Diversity: 28.46
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
GAGUGAGUUCUUGCUCUCAGGGCACUUAGUUCCCAUGAGAACAGGUUGUUAUAAAAAUGAGUUUGGCUUCCCAGGCUCUCUCGUUUCCUCUCUUGCCAUGUGAUUUCUCUGCACCCGCCU
(((.(((..((((.((((((((.((...)).))).))))).)))).............((((((((....)))))))).........))).)))((...(((.........)))..))..
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 18,915,641
Ending coordinate (hg38): 18,915,760
Minimum free energy (kcal/mol): -38
z-score: -2.55
p-value of z-score: 0
Ensemble Diversity: 12.029999999999999
Frequency of MFE in ensemble: 0.08
Sequence & Folding Structure:
CAGAUCCUUCAUGAAUGGAUUAAUGCCUUCCUAUGGGGGUGAGUGAGUUCUUGCUCUCAGGGCACUUAGUUCCCAUGAGAACAGGUUGUUAUAAAAAUGAGUUUGGCUUCCCAGGCUCUC
.....((((((((...((((((((((((.....((((((((((......))))))))))))))).))))))).)))))....))).............((((((((....))))))))..
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 18,915,681
Ending coordinate (hg38): 18,915,800
Minimum free energy (kcal/mol): -39.6
z-score: -1.88
p-value of z-score: 0.03
Ensemble Diversity: 29.64
Frequency of MFE in ensemble: 0.03
Sequence & Folding Structure:
GAGAGGUGGGGCCUAGUGGGAGAUGUUUGGGUCACAGAGGCAGAUCCUUCAUGAAUGGAUUAAUGCCUUCCUAUGGGGGUGAGUGAGUUCUUGCUCUCAGGGCACUUAGUUCCCAUGAGA
.....((((((.((((((...(((......)))...(((((((((((.........)))))..))))))(((.((((((((((......)))))))))))))))).))).))))))....
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 18,915,721
Ending coordinate (hg38): 18,915,840
Minimum free energy (kcal/mol): -33.9
z-score: -1.58
p-value of z-score: 0
Ensemble Diversity: 15.050000000000001
Frequency of MFE in ensemble: 0.07
Sequence & Folding Structure:
CUCAAAAAAAAAAAAAAAUUGAUCCCCAGUGUGCGCUAUUGAGAGGUGGGGCCUAGUGGGAGAUGUUUGGGUCACAGAGGCAGAUCCUUCAUGAAUGGAUUAAUGCCUUCCUAUGGGGGU
((((.................(((((((.((.((.(((((....))))).)).)).)))).)))...((((.....(((((((((((.........)))))..))))))))))))))...
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 18,915,761
Ending coordinate (hg38): 18,915,880
Minimum free energy (kcal/mol): -32.4
z-score: -0.67
p-value of z-score: 0.22
Ensemble Diversity: 37.34
Frequency of MFE in ensemble: 0.06
Sequence & Folding Structure:
ACCACUGCACUCCAGCCUGGGCGACAGAGCAAGACUCCGUCUCAAAAAAAAAAAAAAAUUGAUCCCCAGUGUGCGCUAUUGAGAGGUGGGGCCUAGUGGGAGAUGUUUGGGUCACAGAGG
.........(((..(((((((((((.(((.....))).)))....................(((((((.((.((.(((((....))))).)).)).)))).)))))))))))....))).
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 18,915,801
Ending coordinate (hg38): 18,915,920
Minimum free energy (kcal/mol): -33.3
z-score: -1.94
p-value of z-score: 0
Ensemble Diversity: 15.69
Frequency of MFE in ensemble: 0.03
Sequence & Folding Structure:
UUGAACCCAGGAGGUGGAGCUUGCAGUGAGCCAAAAUCGUACCACUGCACUCCAGCCUGGGCGACAGAGCAAGACUCCGUCUCAAAAAAAAAAAAAAAUUGAUCCCCAGUGUGCGCUAUU
.....((((((...(((((..(((((((..............)))))))))))).)))))).(((.(((.....))).)))................((((.....))))..........
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 18,915,841
Ending coordinate (hg38): 18,915,960
Minimum free energy (kcal/mol): -48.4
z-score: -2.77
p-value of z-score: 0
Ensemble Diversity: 7.27
Frequency of MFE in ensemble: 0.09
Sequence & Folding Structure:
GUAGUCCCAGCUACUCGGGAGGCUGAGGCAGGAGAACUGCUUGAACCCAGGAGGUGGAGCUUGCAGUGAGCCAAAAUCGUACCACUGCACUCCAGCCUGGGCGACAGAGCAAGACUCCGU
...(((.(((((........))))).))).((((...(((((...((((((...(((((..(((((((..............)))))))))))).)))))).....)))))...))))..
Forna Structure: Visualize MFE with FORNA
CSV