Data Search

Find folding metrics (explained here) within the human reference genome (GRCh38/hg38) based on their genomic coordinates, or find specific regions which have interesting folding properties (by filtering based on their folding metric values).

You can browse the data visually using JBrowse - user guide here.

If you would like to find data for specific genes use the Gene Search tool.

Users are limited to downloading about 2.5 million nucleotides worth of a data at a time. If you would like the entire data set it can be found here.

Download your results by clicking the "CSV" download button at the bottom of the page.

Select data from a specific chromosome.
Data export restricted to 2.5M nucleotides at a time.
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,157,401
Ending coordinate (hg38): 2,157,520
Minimum free energy (kcal/mol): -30.9
z-score: -0.77
p-value of z-score: 0.16
Ensemble Diversity: 38.81
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
CCUUCCACUUACCUUUGUGAUAGGGGUACCAAAAUCUGUUUACCCUCAUCUUUGCUCUCUUCCAGAGGAACAGGAGAGGUAGUUGGGUCAGUGUGCCAGAAAAGCAGAAGUUGAGUAUGU
(((..(((........)))..))).(((((((..(((((((..((((.(((((.((((.....)))).)).))).))))...((((.........))))..)))))))..))).))))..
JBrowse Link: chr17:2,157,401..2,157,520
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,157,441
Ending coordinate (hg38): 2,157,560
Minimum free energy (kcal/mol): -31.9
z-score: -0.94
p-value of z-score: 0.12
Ensemble Diversity: 35.73
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
GUUGGGUGGUACUUAGUAAGCAUGCUUCUAAUUGUGGUUCCCUUCCACUUACCUUUGUGAUAGGGGUACCAAAAUCUGUUUACCCUCAUCUUUGCUCUCUUCCAGAGGAACAGGAGAGGU
..(((((...)))))(((((((.(......(((.(((((((((..(((........)))..))))).)))).)))))))))))((((.(((((.((((.....)))).)).))).)))).
JBrowse Link: chr17:2,157,441..2,157,560
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,157,441
Ending coordinate (hg38): 2,157,560
Minimum free energy (kcal/mol): -31.9
z-score: -0.94
p-value of z-score: 0.12
Ensemble Diversity: 35.73
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
GUUGGGUGGUACUUAGUAAGCAUGCUUCUAAUUGUGGUUCCCUUCCACUUACCUUUGUGAUAGGGGUACCAAAAUCUGUUUACCCUCAUCUUUGCUCUCUUCCAGAGGAACAGGAGAGGU
..(((((...)))))(((((((.(......(((.(((((((((..(((........)))..))))).)))).)))))))))))((((.(((((.((((.....)))).)).))).)))).
JBrowse Link: chr17:2,157,441..2,157,560
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,157,441
Ending coordinate (hg38): 2,157,560
Minimum free energy (kcal/mol): -31.9
z-score: -0.94
p-value of z-score: 0.12
Ensemble Diversity: 35.73
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
GUUGGGUGGUACUUAGUAAGCAUGCUUCUAAUUGUGGUUCCCUUCCACUUACCUUUGUGAUAGGGGUACCAAAAUCUGUUUACCCUCAUCUUUGCUCUCUUCCAGAGGAACAGGAGAGGU
..(((((...)))))(((((((.(......(((.(((((((((..(((........)))..))))).)))).)))))))))))((((.(((((.((((.....)))).)).))).)))).
JBrowse Link: chr17:2,157,441..2,157,560
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,157,441
Ending coordinate (hg38): 2,157,560
Minimum free energy (kcal/mol): -31.9
z-score: -0.94
p-value of z-score: 0.12
Ensemble Diversity: 35.73
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
GUUGGGUGGUACUUAGUAAGCAUGCUUCUAAUUGUGGUUCCCUUCCACUUACCUUUGUGAUAGGGGUACCAAAAUCUGUUUACCCUCAUCUUUGCUCUCUUCCAGAGGAACAGGAGAGGU
..(((((...)))))(((((((.(......(((.(((((((((..(((........)))..))))).)))).)))))))))))((((.(((((.((((.....)))).)).))).)))).
JBrowse Link: chr17:2,157,441..2,157,560
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,157,441
Ending coordinate (hg38): 2,157,560
Minimum free energy (kcal/mol): -31.9
z-score: -0.94
p-value of z-score: 0.12
Ensemble Diversity: 35.73
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
GUUGGGUGGUACUUAGUAAGCAUGCUUCUAAUUGUGGUUCCCUUCCACUUACCUUUGUGAUAGGGGUACCAAAAUCUGUUUACCCUCAUCUUUGCUCUCUUCCAGAGGAACAGGAGAGGU
..(((((...)))))(((((((.(......(((.(((((((((..(((........)))..))))).)))).)))))))))))((((.(((((.((((.....)))).)).))).)))).
JBrowse Link: chr17:2,157,441..2,157,560
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,157,441
Ending coordinate (hg38): 2,157,560
Minimum free energy (kcal/mol): -31.9
z-score: -0.94
p-value of z-score: 0.12
Ensemble Diversity: 35.73
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
GUUGGGUGGUACUUAGUAAGCAUGCUUCUAAUUGUGGUUCCCUUCCACUUACCUUUGUGAUAGGGGUACCAAAAUCUGUUUACCCUCAUCUUUGCUCUCUUCCAGAGGAACAGGAGAGGU
..(((((...)))))(((((((.(......(((.(((((((((..(((........)))..))))).)))).)))))))))))((((.(((((.((((.....)))).)).))).)))).
JBrowse Link: chr17:2,157,441..2,157,560
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,157,481
Ending coordinate (hg38): 2,157,600
Minimum free energy (kcal/mol): -28.4
z-score: -1.95
p-value of z-score: 0.03
Ensemble Diversity: 25.93
Frequency of MFE in ensemble: 0.03
Sequence & Folding Structure:
UUUCUGCCUUCUUCCCUUUGGCCUGCUCAGUCAUACUCAUGUUGGGUGGUACUUAGUAAGCAUGCUUCUAAUUGUGGUUCCCUUCCACUUACCUUUGUGAUAGGGGUACCAAAAUCUGUU
.....(((...........)))((((((((.(((....)))))))))))...((((.(((....)))))))...(((((((((..(((........)))..))))).)))).........
JBrowse Link: chr17:2,157,481..2,157,600
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,157,481
Ending coordinate (hg38): 2,157,600
Minimum free energy (kcal/mol): -28.4
z-score: -1.95
p-value of z-score: 0.03
Ensemble Diversity: 25.93
Frequency of MFE in ensemble: 0.03
Sequence & Folding Structure:
UUUCUGCCUUCUUCCCUUUGGCCUGCUCAGUCAUACUCAUGUUGGGUGGUACUUAGUAAGCAUGCUUCUAAUUGUGGUUCCCUUCCACUUACCUUUGUGAUAGGGGUACCAAAAUCUGUU
.....(((...........)))((((((((.(((....)))))))))))...((((.(((....)))))))...(((((((((..(((........)))..))))).)))).........
JBrowse Link: chr17:2,157,481..2,157,600
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,157,481
Ending coordinate (hg38): 2,157,600
Minimum free energy (kcal/mol): -28.4
z-score: -1.95
p-value of z-score: 0.03
Ensemble Diversity: 25.93
Frequency of MFE in ensemble: 0.03
Sequence & Folding Structure:
UUUCUGCCUUCUUCCCUUUGGCCUGCUCAGUCAUACUCAUGUUGGGUGGUACUUAGUAAGCAUGCUUCUAAUUGUGGUUCCCUUCCACUUACCUUUGUGAUAGGGGUACCAAAAUCUGUU
.....(((...........)))((((((((.(((....)))))))))))...((((.(((....)))))))...(((((((((..(((........)))..))))).)))).........
JBrowse Link: chr17:2,157,481..2,157,600
Forna Structure: Visualize MFE with FORNA
CSV