Data Search

Find folding metrics (explained here) within the human reference genome (GRCh38/hg38) based on their genomic coordinates, or find specific regions which have interesting folding properties (by filtering based on their folding metric values).

You can browse the data visually using JBrowse - user guide here.

If you would like to find data for specific genes use the Gene Search tool.

Users are limited to downloading about 2.5 million nucleotides worth of a data at a time. If you would like the entire data set it can be found here.

Download your results by clicking the "CSV" download button at the bottom of the page.

Select data from a specific chromosome.
Data export restricted to 2.5M nucleotides at a time.
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,162,521
Ending coordinate (hg38): 2,162,640
Minimum free energy (kcal/mol): -31.2
z-score: -3.36
p-value of z-score: 0
Ensemble Diversity: 16.31
Frequency of MFE in ensemble: 0.06
Sequence & Folding Structure:
UCAGGCUGGUCUUGAACUCCUGGCUUCAAGCAGUAUUCCCGCCUCAGCUUCCUGAAUAGCUGGGAUUGCAGGUACAAACCACCAUGUCCAGCACUGAUUUUUUUUUUUUUUUUUUUUUUU
(((((((((.(.((........(((...))).(((.((((((.((((....))))...)).)))).))).(((....)))..)).).))))).)))).......................
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,162,561
Ending coordinate (hg38): 2,162,680
Minimum free energy (kcal/mol): -29
z-score: -0.12
p-value of z-score: 0.45
Ensemble Diversity: 48.46
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
AUUUGUUUAUUUAUUAGAGACAGGAUCUCAGCUGUGUUCCUCAGGCUGGUCUUGAACUCCUGGCUUCAAGCAGUAUUCCCGCCUCAGCUUCCUGAAUAGCUGGGAUUGCAGGUACAAACC
...(((((........(((.((((((..(((((.((.....)))))))))))))..)))........)))))(((.((((((.((((....))))...)).)))).))).(((....)))
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,162,561
Ending coordinate (hg38): 2,162,680
Minimum free energy (kcal/mol): -29
z-score: -0.12
p-value of z-score: 0.45
Ensemble Diversity: 48.46
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
AUUUGUUUAUUUAUUAGAGACAGGAUCUCAGCUGUGUUCCUCAGGCUGGUCUUGAACUCCUGGCUUCAAGCAGUAUUCCCGCCUCAGCUUCCUGAAUAGCUGGGAUUGCAGGUACAAACC
...(((((........(((.((((((..(((((.((.....)))))))))))))..)))........)))))(((.((((((.((((....))))...)).)))).))).(((....)))
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,162,561
Ending coordinate (hg38): 2,162,680
Minimum free energy (kcal/mol): -29
z-score: -0.12
p-value of z-score: 0.45
Ensemble Diversity: 48.46
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
AUUUGUUUAUUUAUUAGAGACAGGAUCUCAGCUGUGUUCCUCAGGCUGGUCUUGAACUCCUGGCUUCAAGCAGUAUUCCCGCCUCAGCUUCCUGAAUAGCUGGGAUUGCAGGUACAAACC
...(((((........(((.((((((..(((((.((.....)))))))))))))..)))........)))))(((.((((((.((((....))))...)).)))).))).(((....)))
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,162,561
Ending coordinate (hg38): 2,162,680
Minimum free energy (kcal/mol): -29
z-score: -0.12
p-value of z-score: 0.45
Ensemble Diversity: 48.46
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
AUUUGUUUAUUUAUUAGAGACAGGAUCUCAGCUGUGUUCCUCAGGCUGGUCUUGAACUCCUGGCUUCAAGCAGUAUUCCCGCCUCAGCUUCCUGAAUAGCUGGGAUUGCAGGUACAAACC
...(((((........(((.((((((..(((((.((.....)))))))))))))..)))........)))))(((.((((((.((((....))))...)).)))).))).(((....)))
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,162,561
Ending coordinate (hg38): 2,162,680
Minimum free energy (kcal/mol): -29
z-score: -0.12
p-value of z-score: 0.45
Ensemble Diversity: 48.46
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
AUUUGUUUAUUUAUUAGAGACAGGAUCUCAGCUGUGUUCCUCAGGCUGGUCUUGAACUCCUGGCUUCAAGCAGUAUUCCCGCCUCAGCUUCCUGAAUAGCUGGGAUUGCAGGUACAAACC
...(((((........(((.((((((..(((((.((.....)))))))))))))..)))........)))))(((.((((((.((((....))))...)).)))).))).(((....)))
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,162,561
Ending coordinate (hg38): 2,162,680
Minimum free energy (kcal/mol): -29
z-score: -0.12
p-value of z-score: 0.45
Ensemble Diversity: 48.46
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
AUUUGUUUAUUUAUUAGAGACAGGAUCUCAGCUGUGUUCCUCAGGCUGGUCUUGAACUCCUGGCUUCAAGCAGUAUUCCCGCCUCAGCUUCCUGAAUAGCUGGGAUUGCAGGUACAAACC
...(((((........(((.((((((..(((((.((.....)))))))))))))..)))........)))))(((.((((((.((((....))))...)).)))).))).(((....)))
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,162,601
Ending coordinate (hg38): 2,162,720
Minimum free energy (kcal/mol): -27.2
z-score: -0.57
p-value of z-score: 0.22
Ensemble Diversity: 16.57
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
AGGUAGAUGGAUGACUGGAUAUAAGUGAAGUUUUUUGGUUAUUUGUUUAUUUAUUAGAGACAGGAUCUCAGCUGUGUUCCUCAGGCUGGUCUUGAACUCCUGGCUUCAAGCAGUAUUCCC
(((((((((((((((((((..............)))))))))))))))))))....(((.((((((..(((((.((.....)))))))))))))..)))(((........))).......
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,162,601
Ending coordinate (hg38): 2,162,720
Minimum free energy (kcal/mol): -27.2
z-score: -0.57
p-value of z-score: 0.22
Ensemble Diversity: 16.57
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
AGGUAGAUGGAUGACUGGAUAUAAGUGAAGUUUUUUGGUUAUUUGUUUAUUUAUUAGAGACAGGAUCUCAGCUGUGUUCCUCAGGCUGGUCUUGAACUCCUGGCUUCAAGCAGUAUUCCC
(((((((((((((((((((..............)))))))))))))))))))....(((.((((((..(((((.((.....)))))))))))))..)))(((........))).......
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 2,162,601
Ending coordinate (hg38): 2,162,720
Minimum free energy (kcal/mol): -27.2
z-score: -0.57
p-value of z-score: 0.22
Ensemble Diversity: 16.57
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
AGGUAGAUGGAUGACUGGAUAUAAGUGAAGUUUUUUGGUUAUUUGUUUAUUUAUUAGAGACAGGAUCUCAGCUGUGUUCCUCAGGCUGGUCUUGAACUCCUGGCUUCAAGCAGUAUUCCC
(((((((((((((((((((..............)))))))))))))))))))....(((.((((((..(((((.((.....)))))))))))))..)))(((........))).......
Forna Structure: Visualize MFE with FORNA
CSV