Data Search

Find folding metrics (explained here) within the human reference genome (GRCh38/hg38) based on their genomic coordinates, or find specific regions which have interesting folding properties (by filtering based on their folding metric values).

You can browse the data visually using JBrowse - user guide here.

If you would like to find data for specific genes use the Gene Search tool.

Users are limited to downloading about 2.5 million nucleotides worth of a data at a time. If you would like the entire data set it can be found here.

Download your results by clicking the "CSV" download button at the bottom of the page.

Select data from a specific chromosome.
Data export restricted to 2.5M nucleotides at a time.
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 25,231,481
Ending coordinate (hg38): 25,231,600
Minimum free energy (kcal/mol): -19.3
z-score: -2.29
p-value of z-score: 0
Ensemble Diversity: 11.72
Frequency of MFE in ensemble: 0.03
Sequence & Folding Structure:
UCUAGUUUUUCUAUGAAGCUAUUCCCUUUACUACCAUAGGCCUCAAAGCGCUCCAAAUCUCCACUUGCACAUUCCACAACAAGAGUGUUUCCAAACUGCUCUAUCAAUAGGAAUGUUCAA
..(((((((.....))))))).................(((((...)).))).............((.(((((((......((((((((....))).))))).......))))))).)).
JBrowse Link: chr17:25,231,481..25,231,600
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 25,231,521
Ending coordinate (hg38): 25,231,640
Minimum free energy (kcal/mol): -9.5
z-score: 0.653
p-value of z-score: 0.74
Ensemble Diversity: 20.55
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
GAAUACAAACAUCACCAAAAAGUUCCUGAGAAUGCAUCUGUCUAGUUUUUCUAUGAAGCUAUUCCCUUUACUACCAUAGGCCUCAAAGCGCUCCAAAUCUCCACUUGCACAUUCCACAAC
..........................((.(((((((..((..(((((((.....))))))).................(((((...)).))).........))..))))..)))))....
JBrowse Link: chr17:25,231,521..25,231,640
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 25,231,561
Ending coordinate (hg38): 25,231,680
Minimum free energy (kcal/mol): -22.4
z-score: -1.02
p-value of z-score: 0.12
Ensemble Diversity: 15.96
Frequency of MFE in ensemble: 0.05
Sequence & Folding Structure:
AUAGCUGCUCUUUCCAAAGGAAAGUUCAACUCUGGGAGUUGAAUACAAACAUCACCAAAAAGUUCCUGAGAAUGCAUCUGUCUAGUUUUUCUAUGAAGCUAUUCCCUUUACUACCAUAGG
((((.(((..((((...(((((.(((((((((...)))))))))..................)))))))))..))).)))).(((((((.....)))))))...(((..........)))
JBrowse Link: chr17:25,231,561..25,231,680
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 25,231,601
Ending coordinate (hg38): 25,231,720
Minimum free energy (kcal/mol): -23.4
z-score: -1.35
p-value of z-score: 0.06
Ensemble Diversity: 13.66
Frequency of MFE in ensemble: 0.02
Sequence & Folding Structure:
UCCAAACGUCCACUUGCAGAUUCUAGAAAAAGAGUGUUUCAUAGCUGCUCUUUCCAAAGGAAAGUUCAACUCUGGGAGUUGAAUACAAACAUCACCAAAAAGUUCCUGAGAAUGCAUCUG
..........((..((((..(((..(((..((((((((....))).)))))((((...)))).(((((((((...)))))))))..................)))..)))..))))..))
JBrowse Link: chr17:25,231,601..25,231,720
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 25,231,641
Ending coordinate (hg38): 25,231,760
Minimum free energy (kcal/mol): -21.7
z-score: -0.78
p-value of z-score: 0.19
Ensemble Diversity: 29.54
Frequency of MFE in ensemble: 0.03
Sequence & Folding Structure:
GGUGAAGAUAUUUCCUUUUCCACCACAAACCACAAAGCCCUCCAAACGUCCACUUGCAGAUUCUAGAAAAAGAGUGUUUCAUAGCUGCUCUUUCCAAAGGAAAGUUCAACUCUGGGAGUU
((((.(((........))).))))...........................((((.((((((((....((((((((((....))).)))))))....)))).........)))).)))).
JBrowse Link: chr17:25,231,641..25,231,760
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 25,231,681
Ending coordinate (hg38): 25,231,800
Minimum free energy (kcal/mol): -16.4
z-score: 0.284
p-value of z-score: 0.58
Ensemble Diversity: 31.78
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
UCACAGAGAAGCUUCUGAGAAUGCUUCUAUCUAGUAUUUAGGUGAAGAUAUUUCCUUUUCCACCACAAACCACAAAGCCCUCCAAACGUCCACUUGCAGAUUCUAGAAAAAGAGUGUUUC
...(((((....))))).((((((((...(((((......((((.(((........))).))))...............((.(((........))).))...)))))....)))))))).
JBrowse Link: chr17:25,231,681..25,231,800
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 25,231,721
Ending coordinate (hg38): 25,231,840
Minimum free energy (kcal/mol): -29.2
z-score: -1.79
p-value of z-score: 0.03
Ensemble Diversity: 21.94
Frequency of MFE in ensemble: 0.05
Sequence & Folding Structure:
CUCAAAAGGAGUGUUCAACUCCGUGAGUUGAAUGCAGUCAUCACAGAGAAGCUUCUGAGAAUGCUUCUAUCUAGUAUUUAGGUGAAGAUAUUUCCUUUUCCACCACAAACCACAAAGCCC
...((((((((((((((((((...))))))))))).(((.((((..(((((((((...))).))))))..(((.....))))))).)))...))))))).....................
JBrowse Link: chr17:25,231,721..25,231,840
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 25,231,761
Ending coordinate (hg38): 25,231,880
Minimum free energy (kcal/mol): -30.3
z-score: -2.05
p-value of z-score: 0.03
Ensemble Diversity: 33.84
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
CCUUGCAGAUGCCACAGAAAGAGAGUUUCAAAACUGCGCUCUCAAAAGGAGUGUUCAACUCCGUGAGUUGAAUGCAGUCAUCACAGAGAAGCUUCUGAGAAUGCUUCUAUCUAGUAUUUA
......((((((...(((..((((((..((....)).)))))).......(((((((((((...)))))))))))...........(((((((((...))).)))))).))).)))))).
JBrowse Link: chr17:25,231,761..25,231,880
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 25,231,801
Ending coordinate (hg38): 25,231,920
Minimum free energy (kcal/mol): -28.1
z-score: -1.19
p-value of z-score: 0.06
Ensemble Diversity: 24.02
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
UUCCGUUUCCAACGAAAUCUUCAAAGAGGUCUACAUGUCCCCUUGCAGAUGCCACAGAAAGAGAGUUUCAAAACUGCGCUCUCAAAAGGAGUGUUCAACUCCGUGAGUUGAAUGCAGUCA
.(((.((((.......((((.(((.(.((.(.....).))).))).))))......))))((((((..((....)).))))))....)))(((((((((((...))))))))))).....
JBrowse Link: chr17:25,231,801..25,231,920
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 25,231,841
Ending coordinate (hg38): 25,231,960
Minimum free energy (kcal/mol): -22.9
z-score: -0.13
p-value of z-score: 0.41
Ensemble Diversity: 23.31
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
AUUCUGAGACUGCUUCUGUAUAGUUUUUAUGUGAAGAUGAUUCCGUUUCCAACGAAAUCUUCAAAGAGGUCUACAUGUCCCCUUGCAGAUGCCACAGAAAGAGAGUUUCAAAACUGCGCU
....(((((((.(((((((............(((((((.....((((...))))..)))))))(((.((.(.....).)).)))((....)).)))).)))..)))))))..........
JBrowse Link: chr17:25,231,841..25,231,960
Forna Structure: Visualize MFE with FORNA
CSV