Data Search

Find folding metrics (explained here) within the human reference genome (GRCh38/hg38) based on their genomic coordinates, or find specific regions which have interesting folding properties (by filtering based on their folding metric values).

You can browse the data visually using JBrowse - user guide here.

If you would like to find data for specific genes use the Gene Search tool.

Users are limited to downloading about 2.5 million nucleotides worth of a data at a time. If you would like the entire data set it can be found here.

Download your results by clicking the "CSV" download button at the bottom of the page.

Select data from a specific chromosome.
Data export restricted to 2.5M nucleotides at a time.
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 35,654,721
Ending coordinate (hg38): 35,654,840
Minimum free energy (kcal/mol): -14.8
z-score: -0.21
p-value of z-score: 0.45
Ensemble Diversity: 15.7
Frequency of MFE in ensemble: 0.04
Sequence & Folding Structure:
UAAAUUAGAUGUCAAUUUAAAAAGUAAAAUUCCCACCAAGAAAAUUCCAGGCUCAGAGGGCUUCACUGUGAAUUCCUCCAAACAUUUAAGGAAAAAGUAAAGCCGAUCUUAAAUAAACUC
....((((((....))))))...............((..((....))..))...(((.(((((.(((.....(((((...........)))))..))).)))))..)))...........
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 35,654,761
Ending coordinate (hg38): 35,654,880
Minimum free energy (kcal/mol): -21.1
z-score: -0.70
p-value of z-score: 0.29
Ensemble Diversity: 18.09
Frequency of MFE in ensemble: 0.03
Sequence & Folding Structure:
GUGCAAAGGUCAGGCAAUAACCUUAAUGCUAAGGUUAUUAUAAAUUAGAUGUCAAUUUAAAAAGUAAAAUUCCCACCAAGAAAAUUCCAGGCUCAGAGGGCUUCACUGUGAAUUCCUCCA
.......((((.((.((((((((((....)))))))))).....((((((....))))))..........................)).))))..(((((.((((...)))).)))))..
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 35,654,801
Ending coordinate (hg38): 35,654,920
Minimum free energy (kcal/mol): -30.7
z-score: -2.81
p-value of z-score: 0
Ensemble Diversity: 10.59
Frequency of MFE in ensemble: 0.09
Sequence & Folding Structure:
UGCCCAGUGACAUAUGUUCAACGGCCGUGGUAUCCUGACCGUGCAAAGGUCAGGCAAUAACCUUAAUGCUAAGGUUAUUAUAAAUUAGAUGUCAAUUUAAAAAGUAAAAUUCCCACCAAG
.(((....(((....)))....))).((((...(((((((.......))))))).((((((((((....)))))))))).....((((((....))))))............))))....
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 35,654,841
Ending coordinate (hg38): 35,654,960
Minimum free energy (kcal/mol): -35.7
z-score: -2.93
p-value of z-score: 0
Ensemble Diversity: 18.07
Frequency of MFE in ensemble: 0.04
Sequence & Folding Structure:
AAACAUCACCGCUAGCAUUACCAGUAGUAGAGGCACUGCCUGCCCAGUGACAUAUGUUCAACGGCCGUGGUAUCCUGACCGUGCAAAGGUCAGGCAAUAACCUUAAUGCUAAGGUUAUUA
....(((((.((((((((............((((...))))............)))))....))).)))))..(((((((.......))))))).((((((((((....)))))))))).
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 35,654,881
Ending coordinate (hg38): 35,655,000
Minimum free energy (kcal/mol): -21.6
z-score: 0.510
p-value of z-score: 0.61
Ensemble Diversity: 24.87
Frequency of MFE in ensemble: 0.02
Sequence & Folding Structure:
UAAAAGGAACUCGGCAAAUCUUACCCAGCUUGUUUACCAAAAACAUCACCGCUAGCAUUACCAGUAGUAGAGGCACUGCCUGCCCAGUGACAUAUGUUCAACGGCCGUGGUAUCCUGACC
....(((((((((((...............(((((.....)))))...((.(((..(((...)))..))).))(((((......)))))..............)))).))).))))....
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 35,654,921
Ending coordinate (hg38): 35,655,040
Minimum free energy (kcal/mol): -16.6
z-score: 0.039
p-value of z-score: 0.35
Ensemble Diversity: 29.25
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
AAUCCAACACAGGUAUGCUCUAAGGAAAGAUUACAAACAGUAAAAGGAACUCGGCAAAUCUUACCCAGCUUGUUUACCAAAAACAUCACCGCUAGCAUUACCAGUAGUAGAGGCACUGCC
...........((((((((....((.((((((......(((.......))).....)))))).)).(((.(((((.....))))).....))))))).)))).(((((......))))).
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 35,654,961
Ending coordinate (hg38): 35,655,080
Minimum free energy (kcal/mol): -13
z-score: -0.85
p-value of z-score: 0.19
Ensemble Diversity: 18.87
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
UAAUAAACAAUAUAAUAAACACCCUAUUAUUUAUACUGUUAAUCCAACACAGGUAUGCUCUAAGGAAAGAUUACAAACAGUAAAAGGAACUCGGCAAAUCUUACCCAGCUUGUUUACCAA
.....((((.(((((...............))))).))))...........((((.((.....((.((((((......(((.......))).....)))))).))......)).))))..
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 35,655,001
Ending coordinate (hg38): 35,655,120
Minimum free energy (kcal/mol): -11.1
z-score: -0.07
p-value of z-score: 0.41
Ensemble Diversity: 24.65
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
GCUUAUAUCAGACCGGAAUAAUCCACUGACAGCCUAAUAUUAAUAAACAAUAUAAUAAACACCCUAUUAUUUAUACUGUUAAUCCAACACAGGUAUGCUCUAAGGAAAGAUUACAAACAG
(((....((((...(((....))).)))).))).....(((((((......((((((.......))))))......))))))).........(((..((........))..)))......
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 35,655,041
Ending coordinate (hg38): 35,655,160
Minimum free energy (kcal/mol): -12.6
z-score: -1.44
p-value of z-score: 0.06
Ensemble Diversity: 26.62
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
UGUUAAUAUAAGUAACAUGAAGAUAUUCUCCACUGCAUAAGCUUAUAUCAGACCGGAAUAAUCCACUGACAGCCUAAUAUUAAUAAACAAUAUAAUAAACACCCUAUUAUUUAUACUGUU
(((((((((.((.........((((((((...(((.(((......))))))...))))).)))..........)).)))))))))((((.(((((...............))))).))))
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 35,655,081
Ending coordinate (hg38): 35,655,200
Minimum free energy (kcal/mol): -17.2
z-score: -1.54
p-value of z-score: 0.03
Ensemble Diversity: 21.85
Frequency of MFE in ensemble: 0.02
Sequence & Folding Structure:
UAACAGAUUGGACUAAUCUAUUACUUAAUAGAAGCAAUAAUGUUAAUAUAAGUAACAUGAAGAUAUUCUCCACUGCAUAAGCUUAUAUCAGACCGGAAUAAUCCACUGACAGCCUAAUAU
...(((..((((...((((.(((((((.((..((((....))))..))))))))).....))))....))))))).....(((....((((...(((....))).)))).))).......
Forna Structure: Visualize MFE with FORNA
CSV