Data Search

Find folding metrics (explained here) within the human reference genome (GRCh38/hg38) based on their genomic coordinates, or find specific regions which have interesting folding properties (by filtering based on their folding metric values).

You can browse the data visually using JBrowse - user guide here.

If you would like to find data for specific genes use the Gene Search tool.

Users are limited to downloading about 2.5 million nucleotides worth of a data at a time. If you would like the entire data set it can be found here.

Download your results by clicking the "CSV" download button at the bottom of the page.

Select data from a specific chromosome.
Data export restricted to 2.5M nucleotides at a time.
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 19,822,201
Ending coordinate (hg38): 19,822,320
Minimum free energy (kcal/mol): -41.9
z-score: -3.14
p-value of z-score: 0
Ensemble Diversity: 19.8
Frequency of MFE in ensemble: 0.02
Sequence & Folding Structure:
GUCUUAUUCAUUAGAGUUCUUUAAAAAGUAAGGUUGGGCCAGGCUCAGUGGCUCACGCCUGUAAUCCAGCACCUUGGGAGACCAAGGUGGGUGGAUCGCUUGAGAUUAGGAGUUUGAGAC
.......((.(((((.((((.....((((.(((((((((((.......))))))).))))...(((((.((((((((....))))))))..))))).))))......)))).))))))).
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 19,822,201
Ending coordinate (hg38): 19,822,320
Minimum free energy (kcal/mol): -41.9
z-score: -3.14
p-value of z-score: 0
Ensemble Diversity: 19.8
Frequency of MFE in ensemble: 0.02
Sequence & Folding Structure:
GUCUUAUUCAUUAGAGUUCUUUAAAAAGUAAGGUUGGGCCAGGCUCAGUGGCUCACGCCUGUAAUCCAGCACCUUGGGAGACCAAGGUGGGUGGAUCGCUUGAGAUUAGGAGUUUGAGAC
.......((.(((((.((((.....((((.(((((((((((.......))))))).))))...(((((.((((((((....))))))))..))))).))))......)))).))))))).
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 19,822,201
Ending coordinate (hg38): 19,822,320
Minimum free energy (kcal/mol): -41.9
z-score: -3.14
p-value of z-score: 0
Ensemble Diversity: 19.8
Frequency of MFE in ensemble: 0.02
Sequence & Folding Structure:
GUCUUAUUCAUUAGAGUUCUUUAAAAAGUAAGGUUGGGCCAGGCUCAGUGGCUCACGCCUGUAAUCCAGCACCUUGGGAGACCAAGGUGGGUGGAUCGCUUGAGAUUAGGAGUUUGAGAC
.......((.(((((.((((.....((((.(((((((((((.......))))))).))))...(((((.((((((((....))))))))..))))).))))......)))).))))))).
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 19,822,201
Ending coordinate (hg38): 19,822,320
Minimum free energy (kcal/mol): -41.9
z-score: -3.14
p-value of z-score: 0
Ensemble Diversity: 19.8
Frequency of MFE in ensemble: 0.02
Sequence & Folding Structure:
GUCUUAUUCAUUAGAGUUCUUUAAAAAGUAAGGUUGGGCCAGGCUCAGUGGCUCACGCCUGUAAUCCAGCACCUUGGGAGACCAAGGUGGGUGGAUCGCUUGAGAUUAGGAGUUUGAGAC
.......((.(((((.((((.....((((.(((((((((((.......))))))).))))...(((((.((((((((....))))))))..))))).))))......)))).))))))).
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 19,822,241
Ending coordinate (hg38): 19,822,360
Minimum free energy (kcal/mol): -23.1
z-score: -0.35
p-value of z-score: 0.32
Ensemble Diversity: 36.42
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
AAAAUAAAAUAAGUCACUGGCAUAAACAUAUCCUUUUUAUGUCUUAUUCAUUAGAGUUCUUUAAAAAGUAAGGUUGGGCCAGGCUCAGUGGCUCACGCCUGUAAUCCAGCACCUUGGGAG
...............((.(((....(((((.......)))))((((((..(((((....)))))..))))))..(((((((.......))))))).))).))...((((....))))...
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 19,822,241
Ending coordinate (hg38): 19,822,360
Minimum free energy (kcal/mol): -23.1
z-score: -0.35
p-value of z-score: 0.32
Ensemble Diversity: 36.42
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
AAAAUAAAAUAAGUCACUGGCAUAAACAUAUCCUUUUUAUGUCUUAUUCAUUAGAGUUCUUUAAAAAGUAAGGUUGGGCCAGGCUCAGUGGCUCACGCCUGUAAUCCAGCACCUUGGGAG
...............((.(((....(((((.......)))))((((((..(((((....)))))..))))))..(((((((.......))))))).))).))...((((....))))...
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 19,822,241
Ending coordinate (hg38): 19,822,360
Minimum free energy (kcal/mol): -23.1
z-score: -0.35
p-value of z-score: 0.32
Ensemble Diversity: 36.42
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
AAAAUAAAAUAAGUCACUGGCAUAAACAUAUCCUUUUUAUGUCUUAUUCAUUAGAGUUCUUUAAAAAGUAAGGUUGGGCCAGGCUCAGUGGCUCACGCCUGUAAUCCAGCACCUUGGGAG
...............((.(((....(((((.......)))))((((((..(((((....)))))..))))))..(((((((.......))))))).))).))...((((....))))...
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 19,822,241
Ending coordinate (hg38): 19,822,360
Minimum free energy (kcal/mol): -23.1
z-score: -0.35
p-value of z-score: 0.32
Ensemble Diversity: 36.42
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
AAAAUAAAAUAAGUCACUGGCAUAAACAUAUCCUUUUUAUGUCUUAUUCAUUAGAGUUCUUUAAAAAGUAAGGUUGGGCCAGGCUCAGUGGCUCACGCCUGUAAUCCAGCACCUUGGGAG
...............((.(((....(((((.......)))))((((((..(((((....)))))..))))))..(((((((.......))))))).))).))...((((....))))...
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 19,822,241
Ending coordinate (hg38): 19,822,360
Minimum free energy (kcal/mol): -23.1
z-score: -0.35
p-value of z-score: 0.32
Ensemble Diversity: 36.42
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
AAAAUAAAAUAAGUCACUGGCAUAAACAUAUCCUUUUUAUGUCUUAUUCAUUAGAGUUCUUUAAAAAGUAAGGUUGGGCCAGGCUCAGUGGCUCACGCCUGUAAUCCAGCACCUUGGGAG
...............((.(((....(((((.......)))))((((((..(((((....)))))..))))))..(((((((.......))))))).))).))...((((....))))...
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 19,822,281
Ending coordinate (hg38): 19,822,400
Minimum free energy (kcal/mol): -12.1
z-score: 0.190
p-value of z-score: 0.58
Ensemble Diversity: 32.060000000000002
Frequency of MFE in ensemble: 0.05
Sequence & Folding Structure:
AACAGAGCGAGACUCUAUCUCAAAAAAAAAAAUAAAAUAAAAAAUAAAAUAAGUCACUGGCAUAAACAUAUCCUUUUUAUGUCUUAUUCAUUAGAGUUCUUUAAAAAGUAAGGUUGGGCC
........((((.....)))).....................................(((...(((.....(((((((......((((....))))....)))))))....)))..)))
Forna Structure: Visualize MFE with FORNA
CSV