Data Search

Find folding metrics (explained here) within the human reference genome (GRCh38/hg38) based on their genomic coordinates, or find specific regions which have interesting folding properties (by filtering based on their folding metric values).

You can browse the data visually using JBrowse - user guide here.

If you would like to find data for specific genes use the Gene Search tool.

Users are limited to downloading about 2.5 million nucleotides worth of a data at a time. If you would like the entire data set it can be found here.

Download your results by clicking the "CSV" download button at the bottom of the page.

Select data from a specific chromosome.
Data export restricted to 2.5M nucleotides at a time.
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 4,962,961
Ending coordinate (hg38): 4,963,080
Minimum free energy (kcal/mol): -36
z-score: -2.21
p-value of z-score: 0.03
Ensemble Diversity: 6.36
Frequency of MFE in ensemble: 0.15
Sequence & Folding Structure:
AAGAACUAACUAUAGUCCAGGCAUGGUGGUUCACACCUAUAAUCCCAGCACUUUGGAAGGUCAAGGUGGGAGGAUUACUUGAGGCCAACUGGAGACCAGGAUGGGCAACAAACUGAGACC
..............((((((....((((.....))))..((((((...((((((((....))))))))...)))))).(((..(((..((((...))))....)))..))).))).))).
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 4,962,961
Ending coordinate (hg38): 4,963,080
Minimum free energy (kcal/mol): -36
z-score: -2.21
p-value of z-score: 0.03
Ensemble Diversity: 6.36
Frequency of MFE in ensemble: 0.15
Sequence & Folding Structure:
AAGAACUAACUAUAGUCCAGGCAUGGUGGUUCACACCUAUAAUCCCAGCACUUUGGAAGGUCAAGGUGGGAGGAUUACUUGAGGCCAACUGGAGACCAGGAUGGGCAACAAACUGAGACC
..............((((((....((((.....))))..((((((...((((((((....))))))))...)))))).(((..(((..((((...))))....)))..))).))).))).
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 4,962,961
Ending coordinate (hg38): 4,963,080
Minimum free energy (kcal/mol): -36
z-score: -2.21
p-value of z-score: 0.03
Ensemble Diversity: 6.36
Frequency of MFE in ensemble: 0.15
Sequence & Folding Structure:
AAGAACUAACUAUAGUCCAGGCAUGGUGGUUCACACCUAUAAUCCCAGCACUUUGGAAGGUCAAGGUGGGAGGAUUACUUGAGGCCAACUGGAGACCAGGAUGGGCAACAAACUGAGACC
..............((((((....((((.....))))..((((((...((((((((....))))))))...)))))).(((..(((..((((...))))....)))..))).))).))).
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 4,962,961
Ending coordinate (hg38): 4,963,080
Minimum free energy (kcal/mol): -36
z-score: -2.21
p-value of z-score: 0.03
Ensemble Diversity: 6.36
Frequency of MFE in ensemble: 0.15
Sequence & Folding Structure:
AAGAACUAACUAUAGUCCAGGCAUGGUGGUUCACACCUAUAAUCCCAGCACUUUGGAAGGUCAAGGUGGGAGGAUUACUUGAGGCCAACUGGAGACCAGGAUGGGCAACAAACUGAGACC
..............((((((....((((.....))))..((((((...((((((((....))))))))...)))))).(((..(((..((((...))))....)))..))).))).))).
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 4,962,961
Ending coordinate (hg38): 4,963,080
Minimum free energy (kcal/mol): -36
z-score: -2.21
p-value of z-score: 0.03
Ensemble Diversity: 6.36
Frequency of MFE in ensemble: 0.15
Sequence & Folding Structure:
AAGAACUAACUAUAGUCCAGGCAUGGUGGUUCACACCUAUAAUCCCAGCACUUUGGAAGGUCAAGGUGGGAGGAUUACUUGAGGCCAACUGGAGACCAGGAUGGGCAACAAACUGAGACC
..............((((((....((((.....))))..((((((...((((((((....))))))))...)))))).(((..(((..((((...))))....)))..))).))).))).
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 4,962,961
Ending coordinate (hg38): 4,963,080
Minimum free energy (kcal/mol): -36
z-score: -2.21
p-value of z-score: 0.03
Ensemble Diversity: 6.36
Frequency of MFE in ensemble: 0.15
Sequence & Folding Structure:
AAGAACUAACUAUAGUCCAGGCAUGGUGGUUCACACCUAUAAUCCCAGCACUUUGGAAGGUCAAGGUGGGAGGAUUACUUGAGGCCAACUGGAGACCAGGAUGGGCAACAAACUGAGACC
..............((((((....((((.....))))..((((((...((((((((....))))))))...)))))).(((..(((..((((...))))....)))..))).))).))).
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 4,963,001
Ending coordinate (hg38): 4,963,120
Minimum free energy (kcal/mol): -25.4
z-score: -1.38
p-value of z-score: 0.09
Ensemble Diversity: 16.49
Frequency of MFE in ensemble: 0.05
Sequence & Folding Structure:
ACGCUCAGCCCAAACAUUUAUUUAAUGCCCACAAUGUACAAAGAACUAACUAUAGUCCAGGCAUGGUGGUUCACACCUAUAAUCCCAGCACUUUGGAAGGUCAAGGUGGGAGGAUUACUU
........................(((((.....((((............)))).....)))))((((.....))))..((((((...((((((((....))))))))...))))))...
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 4,963,001
Ending coordinate (hg38): 4,963,120
Minimum free energy (kcal/mol): -25.4
z-score: -1.38
p-value of z-score: 0.09
Ensemble Diversity: 16.49
Frequency of MFE in ensemble: 0.05
Sequence & Folding Structure:
ACGCUCAGCCCAAACAUUUAUUUAAUGCCCACAAUGUACAAAGAACUAACUAUAGUCCAGGCAUGGUGGUUCACACCUAUAAUCCCAGCACUUUGGAAGGUCAAGGUGGGAGGAUUACUU
........................(((((.....((((............)))).....)))))((((.....))))..((((((...((((((((....))))))))...))))))...
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 4,963,001
Ending coordinate (hg38): 4,963,120
Minimum free energy (kcal/mol): -25.4
z-score: -1.38
p-value of z-score: 0.09
Ensemble Diversity: 16.49
Frequency of MFE in ensemble: 0.05
Sequence & Folding Structure:
ACGCUCAGCCCAAACAUUUAUUUAAUGCCCACAAUGUACAAAGAACUAACUAUAGUCCAGGCAUGGUGGUUCACACCUAUAAUCCCAGCACUUUGGAAGGUCAAGGUGGGAGGAUUACUU
........................(((((.....((((............)))).....)))))((((.....))))..((((((...((((((((....))))))))...))))))...
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 4,963,001
Ending coordinate (hg38): 4,963,120
Minimum free energy (kcal/mol): -25.4
z-score: -1.38
p-value of z-score: 0.09
Ensemble Diversity: 16.49
Frequency of MFE in ensemble: 0.05
Sequence & Folding Structure:
ACGCUCAGCCCAAACAUUUAUUUAAUGCCCACAAUGUACAAAGAACUAACUAUAGUCCAGGCAUGGUGGUUCACACCUAUAAUCCCAGCACUUUGGAAGGUCAAGGUGGGAGGAUUACUU
........................(((((.....((((............)))).....)))))((((.....))))..((((((...((((((((....))))))))...))))))...
Forna Structure: Visualize MFE with FORNA
CSV