Data Search

Find folding metrics (explained here) within the human reference genome (GRCh38/hg38) based on their genomic coordinates, or find specific regions which have interesting folding properties (by filtering based on their folding metric values).

You can browse the data visually using JBrowse - user guide here.

If you would like to find data for specific genes use the Gene Search tool.

Users are limited to downloading about 2.5 million nucleotides worth of a data at a time. If you would like the entire data set it can be found here.

Download your results by clicking the "CSV" download button at the bottom of the page.

Select data from a specific chromosome.
Data export restricted to 2.5M nucleotides at a time.
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 32,727,641
Ending coordinate (hg38): 32,727,760
Minimum free energy (kcal/mol): -15.5
z-score: -1.40
p-value of z-score: 0.03
Ensemble Diversity: 17.6
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
CUGACAAUUUUUGUCUUUUGAAUAAAUCAUUUAGUUCAUUUACUUUUAAUAUAGUGUGUGUUGCAUUUAAAUCAGGCAUCUUGUUAAUGCUUCUAUUUGACUCUUCUGUAUUUAUUUUCU
..(((((...)))))....((((((((((...(((.((..((...((((((..((((.((.(........).)).))))..))))))......))..)))))....)).))))))))...
JBrowse Link: chr17:32,727,641..32,727,760
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 32,727,641
Ending coordinate (hg38): 32,727,760
Minimum free energy (kcal/mol): -15.5
z-score: -1.40
p-value of z-score: 0.03
Ensemble Diversity: 17.6
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
CUGACAAUUUUUGUCUUUUGAAUAAAUCAUUUAGUUCAUUUACUUUUAAUAUAGUGUGUGUUGCAUUUAAAUCAGGCAUCUUGUUAAUGCUUCUAUUUGACUCUUCUGUAUUUAUUUUCU
..(((((...)))))....((((((((((...(((.((..((...((((((..((((.((.(........).)).))))..))))))......))..)))))....)).))))))))...
JBrowse Link: chr17:32,727,641..32,727,760
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 32,727,641
Ending coordinate (hg38): 32,727,760
Minimum free energy (kcal/mol): -15.5
z-score: -1.40
p-value of z-score: 0.03
Ensemble Diversity: 17.6
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
CUGACAAUUUUUGUCUUUUGAAUAAAUCAUUUAGUUCAUUUACUUUUAAUAUAGUGUGUGUUGCAUUUAAAUCAGGCAUCUUGUUAAUGCUUCUAUUUGACUCUUCUGUAUUUAUUUUCU
..(((((...)))))....((((((((((...(((.((..((...((((((..((((.((.(........).)).))))..))))))......))..)))))....)).))))))))...
JBrowse Link: chr17:32,727,641..32,727,760
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 32,727,641
Ending coordinate (hg38): 32,727,760
Minimum free energy (kcal/mol): -15.5
z-score: -1.40
p-value of z-score: 0.03
Ensemble Diversity: 17.6
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
CUGACAAUUUUUGUCUUUUGAAUAAAUCAUUUAGUUCAUUUACUUUUAAUAUAGUGUGUGUUGCAUUUAAAUCAGGCAUCUUGUUAAUGCUUCUAUUUGACUCUUCUGUAUUUAUUUUCU
..(((((...)))))....((((((((((...(((.((..((...((((((..((((.((.(........).)).))))..))))))......))..)))))....)).))))))))...
JBrowse Link: chr17:32,727,641..32,727,760
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 32,727,641
Ending coordinate (hg38): 32,727,760
Minimum free energy (kcal/mol): -15.5
z-score: -1.40
p-value of z-score: 0.03
Ensemble Diversity: 17.6
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
CUGACAAUUUUUGUCUUUUGAAUAAAUCAUUUAGUUCAUUUACUUUUAAUAUAGUGUGUGUUGCAUUUAAAUCAGGCAUCUUGUUAAUGCUUCUAUUUGACUCUUCUGUAUUUAUUUUCU
..(((((...)))))....((((((((((...(((.((..((...((((((..((((.((.(........).)).))))..))))))......))..)))))....)).))))))))...
JBrowse Link: chr17:32,727,641..32,727,760
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 32,727,681
Ending coordinate (hg38): 32,727,800
Minimum free energy (kcal/mol): -16.8
z-score: -0.19
p-value of z-score: 0.29
Ensemble Diversity: 26.99
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
AUAAGUAGCAUAUAGUUAGCUUUGAUUUUUUUAAUCCAGUCUGACAAUUUUUGUCUUUUGAAUAAAUCAUUUAGUUCAUUUACUUUUAAUAUAGUGUGUGUUGCAUUUAAAUCAGGCAUC
....(((((((((((((((((..((((.....)))).)).))))).............(((((.((....)).)))))................))))))))))................
JBrowse Link: chr17:32,727,681..32,727,800
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 32,727,681
Ending coordinate (hg38): 32,727,800
Minimum free energy (kcal/mol): -16.8
z-score: -0.19
p-value of z-score: 0.29
Ensemble Diversity: 26.99
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
AUAAGUAGCAUAUAGUUAGCUUUGAUUUUUUUAAUCCAGUCUGACAAUUUUUGUCUUUUGAAUAAAUCAUUUAGUUCAUUUACUUUUAAUAUAGUGUGUGUUGCAUUUAAAUCAGGCAUC
....(((((((((((((((((..((((.....)))).)).))))).............(((((.((....)).)))))................))))))))))................
JBrowse Link: chr17:32,727,681..32,727,800
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 32,727,681
Ending coordinate (hg38): 32,727,800
Minimum free energy (kcal/mol): -16.8
z-score: -0.19
p-value of z-score: 0.29
Ensemble Diversity: 26.99
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
AUAAGUAGCAUAUAGUUAGCUUUGAUUUUUUUAAUCCAGUCUGACAAUUUUUGUCUUUUGAAUAAAUCAUUUAGUUCAUUUACUUUUAAUAUAGUGUGUGUUGCAUUUAAAUCAGGCAUC
....(((((((((((((((((..((((.....)))).)).))))).............(((((.((....)).)))))................))))))))))................
JBrowse Link: chr17:32,727,681..32,727,800
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 32,727,681
Ending coordinate (hg38): 32,727,800
Minimum free energy (kcal/mol): -16.8
z-score: -0.19
p-value of z-score: 0.29
Ensemble Diversity: 26.99
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
AUAAGUAGCAUAUAGUUAGCUUUGAUUUUUUUAAUCCAGUCUGACAAUUUUUGUCUUUUGAAUAAAUCAUUUAGUUCAUUUACUUUUAAUAUAGUGUGUGUUGCAUUUAAAUCAGGCAUC
....(((((((((((((((((..((((.....)))).)).))))).............(((((.((....)).)))))................))))))))))................
JBrowse Link: chr17:32,727,681..32,727,800
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 32,727,681
Ending coordinate (hg38): 32,727,800
Minimum free energy (kcal/mol): -16.8
z-score: -0.19
p-value of z-score: 0.29
Ensemble Diversity: 26.99
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
AUAAGUAGCAUAUAGUUAGCUUUGAUUUUUUUAAUCCAGUCUGACAAUUUUUGUCUUUUGAAUAAAUCAUUUAGUUCAUUUACUUUUAAUAUAGUGUGUGUUGCAUUUAAAUCAGGCAUC
....(((((((((((((((((..((((.....)))).)).))))).............(((((.((....)).)))))................))))))))))................
JBrowse Link: chr17:32,727,681..32,727,800
Forna Structure: Visualize MFE with FORNA
CSV