Data Search

Find folding metrics (explained here) within the human reference genome (GRCh38/hg38) based on their genomic coordinates, or find specific regions which have interesting folding properties (by filtering based on their folding metric values).

You can browse the data visually using JBrowse - user guide here.

If you would like to find data for specific genes use the Gene Search tool.

Users are limited to downloading about 2.5 million nucleotides worth of a data at a time. If you would like the entire data set it can be found here.

Download your results by clicking the "CSV" download button at the bottom of the page.

Select data from a specific chromosome.
Data export restricted to 2.5M nucleotides at a time.
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 16,730,121
Ending coordinate (hg38): 16,730,240
Minimum free energy (kcal/mol): -21
z-score: -0.96
p-value of z-score: 0.16
Ensemble Diversity: 24.46
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
CUAUUCAAUAAAUGGUGUUGGGAAAAUUGAAUAGCCACAUGUAGAAGAAUGAAACUGGAUCCCUAUCUCUCACCAUAUAUAAAAAUUAACUCAAGAUGGAUUAGGCCUAACAUGUGGCUC
.((((((((................))))))))(((((((((.............(((...(((((((.((.......................)).))).)))).))))))))))))..
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 16,730,161
Ending coordinate (hg38): 16,730,280
Minimum free energy (kcal/mol): -15.3
z-score: 0.108
p-value of z-score: 0.48
Ensemble Diversity: 10.65
Frequency of MFE in ensemble: 0.07
Sequence & Folding Structure:
UCACAAAGCGUACAAAGACAUAAACUGGGCAAAGAACACCCUAUUCAAUAAAUGGUGUUGGGAAAAUUGAAUAGCCACAUGUAGAAGAAUGAAACUGGAUCCCUAUCUCUCACCAUAUAU
..........................(((.........)))..........((((((..((((........(((...(((........)))...)))........)))).))))))....
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 16,730,201
Ending coordinate (hg38): 16,730,320
Minimum free energy (kcal/mol): -11.7
z-score: 0.697
p-value of z-score: 0.74
Ensemble Diversity: 22.34
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
ACCUAGAAAUAAAGCCAAAUAUGUAUAACCAACUGACCUUUCACAAAGCGUACAAAGACAUAAACUGGGCAAAGAACACCCUAUUCAAUAAAUGGUGUUGGGAAAAUUGAAUAGCCACAU
.............(((...(((((.........((((((((...)))).)).))...))))).....)))..........(((((((((................)))))))))......
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 16,730,241
Ending coordinate (hg38): 16,730,360
Minimum free energy (kcal/mol): -6.9
z-score: 1.144
p-value of z-score: 0.83
Ensemble Diversity: 22.29
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
UAUAAAAGUACAUACGUAGACCAAUGGAACAGAAUAGAGAACCUAGAAAUAAAGCCAAAUAUGUAUAACCAACUGACCUUUCACAAAGCGUACAAAGACAUAAACUGGGCAAAGAACACC
...........(((((((......(((.......(((.....))).........)))..))))))).......((.(((.........(.......).........))))).........
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 16,730,281
Ending coordinate (hg38): 16,730,400
Minimum free energy (kcal/mol): -13.9
z-score: -0.48
p-value of z-score: 0.25
Ensemble Diversity: 19.35
Frequency of MFE in ensemble: 0.03
Sequence & Folding Structure:
AUAUGACAAGGCUAAAGUAACCAAAACAGCAUGGUACUUGUAUAAAAGUACAUACGUAGACCAAUGGAACAGAAUAGAGAACCUAGAAAUAAAGCCAAAUAUGUAUAACCAACUGACCUU
.......((((...(((((.(((........))))))))((((....))))(((((((......(((.......(((.....))).........)))..)))))))..........))))
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 16,730,321
Ending coordinate (hg38): 16,730,440
Minimum free energy (kcal/mol): -10.6
z-score: 0.558
p-value of z-score: 0.64
Ensemble Diversity: 30.51
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
AGAACGAAGCCAGAGACAUCACAUUACCAGAUCUAAAACCAUAUGACAAGGCUAAAGUAACCAAAACAGCAUGGUACUUGUAUAAAAGUACAUACGUAGACCAAUGGAACAGAAUAGAGA
..........................(((..((((....(.((((((.......(((((.(((........))))))))........)).)))).)))))....))).............
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 16,730,361
Ending coordinate (hg38): 16,730,480
Minimum free energy (kcal/mol): -11.6
z-score: -0.03
p-value of z-score: 0.45
Ensemble Diversity: 16.12
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
CAAAAACGAGCCUGAAUAGCCAAAGCAAUCCCAAGCAAAAAGAACGAAGCCAGAGACAUCACAUUACCAGAUCUAAAACCAUAUGACAAGGCUAAAGUAACCAAAACAGCAUGGUACUUG
........(((((...........((........))................((....))............................))))).(((((.(((........)))))))).
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 16,730,401
Ending coordinate (hg38): 16,730,520
Minimum free energy (kcal/mol): -10.9
z-score: -0.17
p-value of z-score: 0.32
Ensemble Diversity: 18.62
Frequency of MFE in ensemble: 0.03
Sequence & Folding Structure:
CACAGAAUUAGAGGACGUACCCCUAAAAUUCACAGGGAAUCAAAAACGAGCCUGAAUAGCCAAAGCAAUCCCAAGCAAAAAGAACGAAGCCAGAGACAUCACAUUACCAGAUCUAAAACC
....(((((..(((.......)))..))))).((((...((......)).))))..........((........))............................................
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 16,730,441
Ending coordinate (hg38): 16,730,560
Minimum free energy (kcal/mol): -14.4
z-score: -0.33
p-value of z-score: 0.29
Ensemble Diversity: 26.21
Frequency of MFE in ensemble: 0.01
Sequence & Folding Structure:
GAUUCCAUGCAAUUCCUAUUAACAUACCACUGUCAUUCUUCACAGAAUUAGAGGACGUACCCCUAAAAUUCACAGGGAAUCAAAAACGAGCCUGAAUAGCCAAAGCAAUCCCAAGCAAAA
((((((.((....................((((........))))..((((.((......))))))......)).))))))........((.((....((....)).....)).))....
Forna Structure: Visualize MFE with FORNA
Chromosome: chr17
Strandedness: -1
Starting coordinate (hg38): 16,730,481
Ending coordinate (hg38): 16,730,600
Minimum free energy (kcal/mol): -12.3
z-score: -0.44
p-value of z-score: 0.29
Ensemble Diversity: 33.24
Frequency of MFE in ensemble: 0
Sequence & Folding Structure:
AAUAUAGUGAAAAUGAUCAUAUUAACCAAAGCAAUCUACAGAUUCCAUGCAAUUCCUAUUAACAUACCACUGUCAUUCUUCACAGAAUUAGAGGACGUACCCCUAAAAUUCACAGGGAAU
......(((((((((((.............((((((....)))....)))(((....)))...........)))))).))))).(((((..(((.......)))..))))).........
Forna Structure: Visualize MFE with FORNA
CSV