RNAStructuromeDB

NEW: ScanFold results for the COVID-19 strain (SARS-CoV-2) can now be found on the RNAStructuromeDB: here

Browse all the genomes which have been scanned here: https://structurome.bb.iastate.edu/jbrowse/
View the results from a new ScanFold herpesvirus analysis here: https://structurome.bb.iastate.edu/herpesvirus/

About RNAStructuromeDB Gene Search:
Find RNA folding metrics which have been calculated for ~156,000,000 scanning windows canvassing the entire human reference genome (hg38) and linked to annotations for specific gene loci (described within the Gencode comprehensive gene annotation set Version 26): search for one gene at a time (by using the "Is equal to" filter and inputting a single entry), or a list of genes (by using the "Contains any word" filter and inputting a space-separated list of gene symbols or Ensemble IDs).

Description of RNAStructuromeDB folding metrics
RNAStructuromeDB JBrowse tutorial

Not sure what your gene symbol or Ensemble gene ID is?
Search for the official gene symbol at HGNC or Ensemble ID at Ensembl (should be in the format of ENSG00000##.#). To find data outside of gene regions use our Data Search tool.

If you find the RNAStructuromeDB helpful, please consider citing the corresponding manuscript: RNAStructuromeDB: A genome-wide database for RNA structural inference

Results:

To download the complete dataset for VEGFA, click CSV button at bottom of page.

View gene on Ensembl:ENSG00000112715.21
View gene on GeneCards:VEGFA
View VEGFA on JBrowse

Windows with interesting structures (z-score < -1; ranked from most negative to least negative) are displayed below.

Low Z-Score Window # 51
Chromosome: chr6
Strandedness: 1
Starting Coordinate (GRCh38/hg38): 43,781,601
Ending Coordinate (GRCh38/hg38): 43,781,720
Minimum free energy value (kcal/mol): -48.7
Ensemble Diversity: 18.99
Frequency of MFE in Ensemble: 0.06
P-Value (MFE stability ratio): 0
Z-Score: -2.10
Fold: (((((....(((...((((.((((.....((((((((.....((((.(((.(((.((....((((........))))))))).))).)))).))))))))...)))))))))))))))).
Sequence: GCAGGUGAAGAGUCAAGGCGUGCUCCGAUGGGGGCAACAGCAGUUGGGUCCCUGUGGCCUGAGACUCACCCUUGUCUCCCAGAGACACAGCAUUGCCCCUUAUGGCAGCCUCUCCCUGCA
View this window on JBrowse (zoomed in to 120 nt)
Transcript ID: ENSG00000112715.21
------------------------
Low Z-Score Window # 52
Chromosome: chr6
Strandedness: 1
Starting Coordinate (GRCh38/hg38): 43,780,321
Ending Coordinate (GRCh38/hg38): 43,780,440
Minimum free energy value (kcal/mol): -52.9
Ensemble Diversity: 12.12
Frequency of MFE in Ensemble: 0.04
P-Value (MFE stability ratio): 0
Z-Score: -2.09
Fold: ......((((((..(((((((.((((..((((((((.(((((((..((((((......)))))))))((((....)))).)))).)))).)))))))).)...)))))).))))))....
Sequence: ACCCCCGGACCUUCAGGGUCAGACUUGGACAGGGCUGCUGGGCAAAGAGCCUUCCCUCAGGCUUUGCCCCCUGCCGGGGACUGGGAGCCACUGUGAGUGUGGAGACCUUUGGGUCCUGUG
View this window on JBrowse (zoomed in to 120 nt)
Transcript ID: ENSG00000112715.21
------------------------
Low Z-Score Window # 53
Chromosome: chr6
Strandedness: 1
Starting Coordinate (GRCh38/hg38): 43,774,401
Ending Coordinate (GRCh38/hg38): 43,774,520
Minimum free energy value (kcal/mol): -41.8
Ensemble Diversity: 33.76
Frequency of MFE in Ensemble: 0.04
P-Value (MFE stability ratio): 0
Z-Score: -2.08
Fold: .(((((((.((...(((((((((((((((((...))))))))).))))..))))..(((((((((((((......)))))))))))))..)).))).))))...................
Sequence: CCCUGGCUGUUGGAUGGGGUUCCCUGUCCUCUCAGGGGAUGGGUGGAUGGCCUAAUUCCUUUUUCUUCAGAACUGUGGGGAGGAAGGGGAAGGGGCACAGGAAUAUAAGGAUCAAGAAAG
View this window on JBrowse (zoomed in to 120 nt)
Transcript ID: ENSG00000112715.21
------------------------
Low Z-Score Window # 54
Chromosome: chr6
Strandedness: 1
Starting Coordinate (GRCh38/hg38): 43,778,321
Ending Coordinate (GRCh38/hg38): 43,778,440
Minimum free energy value (kcal/mol): -46.4
Ensemble Diversity: 21.64
Frequency of MFE in Ensemble: 0.06
P-Value (MFE stability ratio): 0
Z-Score: -2.08
Fold: (((((..((((.((((.(((.((((((...((((...))))......)))))).)).).))))))))..))))).....((((.((((......)))).))))((((........)))).
Sequence: CUUGGUCCUCCCUGCCUCCACCACCCAUCCCUGCUCUGCAGAACCCCUGGGUGCUGAGUGGCAGGAGCCCCAGGGUUGUCCCAUCUGGGUAUGGCUGGCUGGGUCACUAACCUCUGUGAU
View this window on JBrowse (zoomed in to 120 nt)
Transcript ID: ENSG00000112715.21
------------------------
Low Z-Score Window # 55
Chromosome: chr6
Strandedness: 1
Starting Coordinate (GRCh38/hg38): 43,778,201
Ending Coordinate (GRCh38/hg38): 43,778,320
Minimum free energy value (kcal/mol): -51.9
Ensemble Diversity: 28.34
Frequency of MFE in Ensemble: 0.02
P-Value (MFE stability ratio): 0.03
Z-Score: -2.07
Fold: .....((((.((((((...((((..(((((.(((..((((((((((.((........)).))))))))))))).))))))))).)))))).))))....(((.(((........))))))
Sequence: GAAUUCCCAGCCUGGCCAACCCUUGCAGCCAUGUCUUGGCCUCAAGUGGAACAAGGGCUCCUUGAGGCCAGCAGGGUUGGGGGAGUUGGGGUGGGCCUGAGCCUCUUUCCUGCUAGAGCU
View this window on JBrowse (zoomed in to 120 nt)
Transcript ID: ENSG00000112715.21
------------------------
Low Z-Score Window # 56
Chromosome: chr6
Strandedness: 1
Starting Coordinate (GRCh38/hg38): 43,780,361
Ending Coordinate (GRCh38/hg38): 43,780,480
Minimum free energy value (kcal/mol): -46.1
Ensemble Diversity: 33.59
Frequency of MFE in Ensemble: 0.01
P-Value (MFE stability ratio): 0.03
Z-Score: -2.05
Fold: (((.....))).......((((((((......((((((.((((((......((.(((.(((.(((((....))).)).))).))))))))))))))))).......))))))))......
Sequence: GGCAAAGAGCCUUCCCUCAGGCUUUGCCCCCUGCCGGGGACUGGGAGCCACUGUGAGUGUGGAGACCUUUGGGUCCUGUGCCCUCCACCCAGUCUCGGCUUCCCACCAAAGCCUUGUCAG
View this window on JBrowse (zoomed in to 120 nt)
Transcript ID: ENSG00000112715.21
------------------------
Low Z-Score Window # 57
Chromosome: chr6
Strandedness: 1
Starting Coordinate (GRCh38/hg38): 43,781,361
Ending Coordinate (GRCh38/hg38): 43,781,480
Minimum free energy value (kcal/mol): -54.8
Ensemble Diversity: 25.2
Frequency of MFE in Ensemble: 0.03
P-Value (MFE stability ratio): 0.03
Z-Score: -2.04
Fold: .(((.....((((((((((......(((.(((...((((...))))...)))..)))........))))))))))((((((((((((((......))))))....)))).)))))))...
Sequence: AGCCCCCUAUUCCGGCCCAACCCAUGGCACCCACAGAGGCCUCCUUGCAGGGCAGCCUCUUCCUCUGGGUCGGAGGCUGUGGUGGGCCCUGCCCUGGGCCCUCUGGCCACCAGCGGCCUG
View this window on JBrowse (zoomed in to 120 nt)
Transcript ID: ENSG00000112715.21
------------------------
Low Z-Score Window # 58
Chromosome: chr6
Strandedness: 1
Starting Coordinate (GRCh38/hg38): 43,775,761
Ending Coordinate (GRCh38/hg38): 43,775,880
Minimum free energy value (kcal/mol): -37.3
Ensemble Diversity: 17.67
Frequency of MFE in Ensemble: 0.01
P-Value (MFE stability ratio): 0.03
Z-Score: -2.02
Fold: ...(((....(((((((.((((...)))).))))))).)))(((((...............)))))..((((((((((((((((......))....))))))..))))))))........
Sequence: GUAACCCUUCGUGGGUAGAGAAGGAUUCUGUGCCCAUUGGUGGUCUGGAUAAAAGAAAUAGAGACCUCACAGGAAGCAGUGGACUGGCCUGUUUCCCCACUGUUCUUUCUGUUUUCACAC
View this window on JBrowse (zoomed in to 120 nt)
Transcript ID: ENSG00000112715.21
------------------------
Low Z-Score Window # 59
Chromosome: chr6
Strandedness: 1
Starting Coordinate (GRCh38/hg38): 43,775,481
Ending Coordinate (GRCh38/hg38): 43,775,600
Minimum free energy value (kcal/mol): -33.7
Ensemble Diversity: 29.26
Frequency of MFE in Ensemble: 0.01
P-Value (MFE stability ratio): 0
Z-Score: -2.01
Fold: .........((.((((.(..((((.......(..((((((((...(((((((.........)))))))...)))).))))..).......))))..))))))).(((......)))....
Sequence: CUCCACCUCCCAUGGGACUUGGGGAUUCAUUCCAAGGGGAAGCUUUUUGGGGGAAUUCCUACCCCAGGUCUUUUUACCCUCAGUUACCAACCCCUUGCCCAGGCCAGACCUUCCUGCUAU
View this window on JBrowse (zoomed in to 120 nt)
Transcript ID: ENSG00000112715.21
------------------------
Low Z-Score Window # 60
Chromosome: chr6
Strandedness: 1
Starting Coordinate (GRCh38/hg38): 43,785,801
Ending Coordinate (GRCh38/hg38): 43,785,920
Minimum free energy value (kcal/mol): -17.7
Ensemble Diversity: 35.4
Frequency of MFE in Ensemble: 0.03
P-Value (MFE stability ratio): 0.03
Z-Score: -1.99
Fold: ................(((((((((...(((((((......(((((((..(........)..)))))))))))))).)))))))))..........((((.(((.....)))))))....
Sequence: UAUCCCUUUUUAAUUAGAAAUUAAAACAGUUAAUUUAAUUAAAGAGUAGGGUUUUUUUUCAGUAUUCUUGGUUAAUAUUUAAUUUCAACUAUUUAUGAGAUGUAUCUUUUGCUCUCUCUU
View this window on JBrowse (zoomed in to 120 nt)
Transcript ID: ENSG00000112715.21
------------------------

Pages

Displaying 51 - 60 of 173

Welcome to RNAStructuromeDB! Here you can find RNA folding metrics which have been predicted for 156 million windows canvassing the entire human reference sequence (hg38). We have some helpful materials about folding metrics and a tutorial for using the RNAStructuromeDB JBrowse genome browser below.

Description of RNAStructuromeDB folding metrics.
RNAStructuromeDB JBrowse tutorial.

Have a question that needs to be answered? Ask it.

RNAStructuromeDB gene output for list of genes
Question:
Is there a way to automatically get outputs for a list of genes, one file per gene, using RNAStructuromeDB? Thanks!
Answer:

Yes! You can input a comma-separated list of gene names or ensemble IDs and download all results.

From the "Gene Search" tab change the filter for Gene Name (or...

Read the full answer
What is the RNAStructuromeDB?
Question:
What is this database and how does it work?
Answer:

You can read about the RNA Structurome DB here: Andrews RJ, Baber L, and Moss W. Sci Rep. 2017.

The RNAStructuromeDB is a repository of RNA folding metrics describing...

Read the full answer
What is JBrowse?
Question:
Do you have any tutorials for using JBrowse?
Answer:

We do! Here is a user guide specifically for RNAStructuromeDB: jbrowse.pdf

JBrowse is freely available as part of the generic model organism database...

Read the full answer

Subscribe with RSS

CSV